Introduction
Global climate change is causing environmental shifts such as sea level rise, drought, and flood. The resulting ecosystem changes are leading to changes in the habitats of plants and animals, and a decrease in biodiversity (van der Geest & Warner, 2020). Efforts are ongoing to identify and protect organisms that are threatened by the reduction in biodiversity. Korean fir (Abies koreana) is a native evergreen coniferous species found in sub-alpine regions of South Korea, including the Halla and Jiri mountains. A. koreana is considered vulnerable to climate change and is a protected endangered species (Hong et al., 2011; Lee, 1982; Lee et al., 2010).
Plant responses to environmental stress are important in the mitigation of climate change effects. In recent years, leaf dryness has been observed in large areas of A. koreana woodland. This collective leaf drying phenomenon is thought to be due to complex interrelationships among environmental factors such as high temperature and dry environment, which have emerged as a result of global warming. Although A. koreana has been recognized as a species sensitive to climate change by the South Korean government, only limited research has been conducted into its resilience to environmental stresses (Woo, 2009). It is therefore essential to identify the molecular response mechanisms that underlie the responses to environmental stress and thus gauge the resilience to such stresses in A. koreana (Fig. 1).
To support conservation efforts, our previous research used de novo RNA sequencing to obtain a base transcriptome and examine environmental stress responses in A. koreana. A. koreana was heat-treated to identify genes whose expression changed specifically under high-temperature conditions (Hwang et al., 2018). In this study, a subset of genes that responded to high temperature in the previous analysis were tested as candidate marker genes for diagnosis of natural A. koreana populations vulnerable to high temperature stress.
The results of this analysis will improve the diagnostic aspects of measures to counteract damage to vulnerable ecosystems due to climate change (Park et al., 2018).
Materials|Methods
Identification of candidate genes for diagnosis of vulnerable ecosystems in Abies koreana
Raw read sequences from a previously published A. koreana high-temperature-stress transcriptome (Hwang et al., 2018) were filtered using Trimmomatic (version 0.32; http://www.usadellab.org/cms/index.php?page=trimmomatic) and assembled using Trinity software (version R20140717; https://github.com/trinityrnaseq/trinityrnaseq/wiki). Cluster database at high identity with tolerance (CD-HIT) was used to identify the longest sequences from overlapping fragments. Transcripts were annotated by NCBI-nr BLAST ( https://blast.ncbi.nlm.nih.gov/Blast.cgi) and grouped by predicted gene functions using WEGO ( http://wego.genomics.org.cn/). High-temperature specific genes were classified as those with more than 2-fold increased expression and P-values ≤0.05 with differential expression sequence analysis using RNA-seq by expectation-maximization.
Abies koreana sample collection
A. koreana leaf samples were collected from ecologically stable and vulnerable areas in the Halla and Jiri mountains (Fig. 2). Samples were lyophilized immediately and stored at –80°C for RNA extraction. RNA extraction was performed using a Ribospin Seed/Fruit Kit (GeneAll, Seoul, Korea) according to the manufacturer's instructions.
Quantitative real-time polymerase chain reaction (qRT-PCR)
A. koreana RNA was reverse transcribed to cDNA using a ReverTra Ace-α kit (Toyobo, Osaka, Japan). For qRT-PCR, 1 µL diluted cDNA was added to 10 µL of 2×IQ SYBR Green Supermix, 1 µL of 10 uM forward primer, 1 µL reverse primer, and 7 µL H2O. Reactions were denatured at 95°C for 10 minutes, followed by 55 cycles of 95°C for 15 seconds, 55°C for 15 seconds, and 75°C for 30 seconds. Reactions were performed using a CFX 96 real-time system (Bio-Rad, Hercules, CA, USA), and data were analyzed using the Bio-Rad CFX Manager program. Primers used are listed in Table 1.
Results|Discussion
Identification of high temperature-responsive markers in Abies koreana
To identify high-temperature responsive transcription factors in A. koreana, known transcription factor domains were used to search our previously published A. koreana RNA-seq database (Hwang et al., 2018). Six transcriptional regulators whose expression increased more than 2-fold upon heat exposure were identified, as follows: c93462_g1_i1, c142609_g1_i1, c156586_g1_i1, c173884_g1_i1, c205642_g1_i1, c207159_g1_i1 (Table 2). These six high temperature-induced genes in A. koreana were then assessed for their utility as diagnostic markers for ecologically vulnerable populations using samples from the Halla and Jiri mountains in South Korea.
Evaluation of six high temperature-responsive genes as markers for ecologically vulnerable Abies koreana populations using samples from Halla mountain
Expression of the six candidate marker genes was assessed in samples from ecologically stable (Youngsil region) and vulnerable (Nambuk region) areas of Halla mountain, by qRT-PCR. All six markers exhibited higher expression levels in samples from vulnerable regions compared with samples from stable regions (Fig. 3). Expression was 1.3-fold higher for c156586_g1_i1, 38.6-fold higher for c142609_g1_i1, 507.7-fold higher for c207159_g1_i1, 26.3-fold higher for c173884_g1_i1, 16.5-fold higher for c93462_g1_i1, and 2.9-fold higher for c205642_g1_i1. These results were consistent with qRT-PCR analysis of A. koreana samples collected in 2017 (Park et al., 2017).
Evaluation of six high temperature-responsive genes as markers for ecologically vulnerable Abies koreana populations using samples from Jiri mountain
Expression of the six candidate marker genes was assessed in samples from ecologically stable and vulnerable areas of the Banya and Seseok regions of Jiri mountain, by qRT-PCR. In samples from the Banya region, all six markers exhibited higher expression levels in samples from vulnerable regions compared with samples from stable regions (Fig. 4). Expression was 16.8-fold higher for c156586_g1_i1, 98.6-fold higher for c142609_g1_i1, 198-fold higher for c207159_g1_i1, 11.2-fold higher for c173884_g1_i1, 2.7-fold higher for c93462_g1_i1, and 1.8-fold higher for c205642_g1_i1. In samples from the Seseok region, all six markers also exhibited higher expression levels in samples from vulnerable regions compared with samples from stable regions (Fig. 5). Expression was 2.2-fold higher for c156586_g1_i1, 2.8-fold higher for c142609_g1_i1, 3.4-fold higher for c207159_g1_i1, 3.4-fold higher for c173884_g1_i1, 1.4-fold higher for c93462_g1_i1, and 1.7-fold higher for c205642_g1_i1.
Overall, expression of diagnostic marker genes in ecologically vulnerable and stable regions showed the same trends in A. koreana samples from the Jiri and Halla mountains.
Recent declines in A. koreana have been attributed to heat stress caused by climate change. The purpose of this study was to identify genes with increased expression upon exposure to heat stress, and to assess their utility as diagnostic markers for ecologically vulnerable natural populations of A. koreana. Six candidate marker genes were identified from a heat-stress RNA-seq dataset, and their expression was assessed in leaf samples from ecologically vulnerable and stable natural populations using qRT-PCR. All six markers exhibited elevated expression in samples from vulnerable populations, confirming their value as diagnostic markers.
Figures and Tables
Fig. 1
Schematic representation of identification of heat-induced genes in Abies koreana and their assessment as marker genes for ecologically vulnerable populations.
Fig. 2
Abies koreana sampling locations. (A) Topography of Halla mountain. (B) Topography of Jiri mountain. (C) Image of ecologically stable A. koreana population. (D) Image of ecologically vulnerable A. koreana population. Topography images from https://www.mountain-forecast.com.
Fig. 3
Analysis of candidate diagnostic markers in ecologically stable and vulnerable populations of Abies koreana from Halla mountain. Gene expression in vulnerable samples is shown relative to expression in stable samples, which is set to 1. (A) c93462_g1_i1. (B) c142609_g1_i1. (C) c156586_g1_i1. (D) c173884_g1_i1. (E) c205642_g1_i1. (F) c207159_g1_i1.
Fig. 4
Analysis of candidate diagnostic markers in ecologically stable and vulnerable populations of Abies koreana from the Banya region of Jiri mountain. Gene expression in vulnerable samples is shown relative to expression in stable samples, which is set to 1. (A) c93462_g1_i1. (B) c142609_g1_i1. (C) c156586_g1_i1. (D) c173884_g1_i1. (E) c205642_g1_i1. (F) c207159_g1_i1.
Fig. 5
Analysis of candidate diagnostic markers in ecologically stable and vulnerable populations of Abies koreana from the Seseok region of Jiri mountain. Gene expression in vulnerable samples is shown relative to expression in stable samples, which is set to 1. (A) c93462_g1_i1. (B) c142609_g1_i1. (C) c156586_g1_i1. (D) c173884_g1_i1. (E) c205642_g1_i1. (F) c207159_g1_i1.
Table 1
Primers for quantitative real-time polymerase chain reaction analysis
| Contig | Foerward primer sequence (5`→3`) | Reverse primer sequence (5`→3`) |
|---|---|---|
| c93462_g1_i1 | AAGCGCTGGACAAAGATCAC | TCTTTGCTGATCCCGTCACT |
| c142609_g1_i1 | CGGTTGGATGACTGGGTACT | AGGCAGATTCAGGAGCAACT |
| c156586_g1_i1 | GCGCAGATACGTTCGAGAAA | ACCTTCACCTCCGGATTCAG |
| c173884_g1_i1 | CCAGTGCATTCGGCTCATAC | TTGGCAGCCTGACTTAACCT |
| c205642_g1_i1 | GCATTATTCCCGGCGTTCTT | GTATGCTCCGCGTCCAATAG |
| c207159_g1_i1 | GGCGTCCCTTCTGACTCTAA | TGGCACCATGATTTGGAGGT |
Table 2
High temperature-inducible genes used as candidate diagnostic markers for ecologically vulnerable Abies koreana populations
| Contig | Fold change | BLAST | |
|---|---|---|---|
|
|
|||
| Arabidopsis | Poplar | ||
| c93462_g1_i1 | 44.1 | AT4G38810.2 | Calcium-binding EF-hand family protein |
Potri.009G127800.1 |
| c142609_g1_i1 | 84.7 | AT1G69490.1 | NAP, ANAC029, ATNAP |
Potri.001G404400.1 |
| c156586_g1_i1 | 13.9 | AT5G12030.1 | AT-HSP17.6A, HSP17.6, HSP17.6A |
Potri.006G223900.1 |
| c173884_g1_i1 | 7.1 | AT5G56960.1 | bHLH DNA-binding family protein |
Potri.006G148800.1 |
| c205642_g1_i1 | 2.9 | AT2G43790.1 | ATMPK6, MPK6, MAPK6, ATMAPK6 |
Potri.007G139800.1 |
| c207159_g1_i1 | 40.4 | AT5G35550.1 | TT2, ATMYB123, MYB123, ATTT2 |
Potri.006G221800.1 |