Your browser does not support the NLM PubReader view.
Go to this page to see a list of supporting browsers.

Introduction

Viruses are obligate parasites that require hosts for their replication. As they replicate within their hosts, viruses mutate and develop quasispecies, selected for the next generation. While most viral mutations are deleterious, a sufficiently large population of variants can confer some with the capacity for interspecies transmission or the evasion of virus-specific immune responses (Acevedo et al., 2014; McCrone & Lauring, 2018).

DNA viruses typically have mutation rates ranging from 10−8 to 10−6 substitutions per nucleotide site per cell infection (s/n/c), while RNA viruses exhibit higher mutation rates between 10−6 and 10−4 s/n/c (Peck & Lauring, 2018). High mutation rates allow viruses to adapt and survive in specific host environments through selected mutations. The pressures that select for the next generation of viruses and their mutants are varied and include factors such as antiviral agents, immune responses, and host switching, all of which influence viral fitness within the environment (Wargo & Kurath, 2012).

Host switching is relatively rare, as viruses typically infect a narrow range of host species, though this spectrum varies among different viruses (Rothenburg & Brennan, 2020). Nevertheless, as observed with the recently emergent severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), which is linked to the intermediate horseshoe bat (Rhinolophus affinis) and the Malayan pangolin (Manis javanica), viruses can switch hosts, potentially leading to pandemics in new host species (Lam et al., 2020; Zhou et al., 2020). Consequently, studying viral mutations across different host species can offer insights into viral evolution and help prepare for future pandemics.

In this study, we used the Shaan virus isolate (B16-40), a novel species from the family Paramyxoviridae originating from bats (Noh et al., 2018). Considering that recent viruses affecting humans have originated from bats, studying a novel paramyxovirus from bats, previously unknown to infect humans, is crucial for understanding its mutation patterns and potential to infect humans. In this context, both high- and low-passaged Shaan viruses in MARC-145 cell lines derived from African green monkey kidney (Kim et al., 1993) were introduced to A549, HEK-293, and HRT-18 cell lines (human origin). These cell lines served as models for different host species. Utilizing population-based analysis, which is important for studying viral evolution due to the quasispecies nature of viruses (Geoghegan & Holmes, 2018), we examined mutations in the high- and low-passaged Shaan viruses from both the original and new host environments using high-throughput sequencing in triplicate.

Materials and Methods

Cells and viruses

MARC-145 cell lines, derived from the kidney of the African green monkey, were cultured in Dulbecco’s Modified Eagle Medium (cat. no. 11995; Gibco, NY, USA), supplemented with antibiotic-antimycotic (100 IU/mL penicillin, 100 μg/mL streptomycin, and 0.25 μg/mL amphotericin B) (cat. no. 15240; Gibco, NY, USA) and 10% fetal bovine serum (cat. no. SV30207; Hyclone, NY, USA). Human-origin HEK-293, A549, and HRT-18 cell lines from kidney, lung, and colon, respectively, were cultured in MEM (cat. no. 10370; Gibco, NY, USA) and RPMI1640 (cat. no. A10491; Gibco, NY, USA) media, supplemented with 10% fetal bovine serum and antibiotic-antimycotic. These cells were maintained at a constant 37°C and 5% CO2 in an incubator.

The Shaan virus isolate (B16-40) (GenBank accession no. MG230624.1) was propagated in MARC-145 cells. For amplification, 1 × 105/mL of MARC-145 cells were seeded in tissue culture flasks using Dulbecco’s Modified Eagle Medium supplemented with 5% fetal bovine serum and incubated overnight. Following this, a MARC-145 cell monolayer was infected with the Shaan virus (B16-40) at a multiplicity of infection (MOI) of 0.1, with the cytopathic effect observed in the infected cells five days post-inoculation. The virus, harvested by freeze-thawing the infected cells, was then used to infect a fresh monolayer of MARC-145 cells for further passages.

Preparation of low-passaged and high-passaged Shaan virus in MARC-145 cells

The original isolate of Shaan virus (B16-40) (GenBank accession no. MG230624.1) was passaged in MARC-145 cells, as depicted in Fig. 1. Low-passaged virus was obtained by serially passing the virus four times in MARC-145 cells, while the high-passaged virus was derived from 44 serial passages in the same cell line. Viral titers of both, low- and high-passaged viruses, were quantified using the tissue culture infectious dose 50 (TCID50) method as described by the Reed-Muench formula.

Host switching of low-passaged and high-passaged Shaan virus

The low-passaged (p4) and high-passaged (p44) Shaan virus samples from MARC-145 cells were inoculated in triplicate into various host cells, specifically HEK-293, A549, and HRT-18 cell lines, originating from human kidney, lung, and colon respectively, as indicated in Fig. 1. Each virus was introduced into these cell lines with a multiplicity of infection (MOI) of 0.5 and allowed to infect for 2 hours. Post-infection, cells were washed with DPBS (pH 7.4) (cat. no. LB001-02; Welgene Inc., Daegu, Korea) and were further incubated with the respective maintenance medium for 24 hours, following protocols established by Lim et al., (2023). Virus harvesting was carried out by freeze-thawing the infected cells, and the collected viruses were then utilized for further quantification and sequencing analyses.

Viral RNA quantification

Total RNA was extracted from harvested samples using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions. Viral RNA was quantified using two real-time RT-PCR methods that targeted total viral RNAs and the viral antigenome. For total viral RNA quantification, cDNAs were synthesized using random hexamers and tested through real-time PCR with a Shaan virus detection primer, which targeted the small hydrophobic (SH) protein region (Supplementary Table 5). Antigenome quantification was performed using a primer designed specifically for the intergenic region between the nucleocapsid and phosphoprotein, suitable for reverse transcription. This antigenome was quantified in real-time PCR using an antigenome-specific primer (Supplementary Table 5). Viral RNA and antigenome levels were normalized to the monkey (for MARC-145 cells) and human GAPDH genes as controls (Das et al., 2000; Shi et al., 2016). Cell lysates from all Shaan virus-infected cells were inoculated into MARC-145 cells, and infectious virion titers were quantified as tissue culture infectious dose 50 (TCID50) using the Reed-Muench method.

Sequencing and analysis

RNA was extracted from infected cells harboring low-passaged (p4) and high-passaged (p44) Shaan virus using TRIzol LS Reagent (Thermo Fisher Scientific Inc.), according to the manufacturer’s manual. RNA samples were analyzed by Macrogen, Inc. (Seoul, Republic of Korea) for high-throughput sequencing and quality assessment. Subsequently, total cDNA libraries, sourced from RNA that met quality standards, were prepared using the Illumina TruSeq Strand Total RNA LT kit according to the manufacturer’s instructions. The samples were sequenced on a NovaSeq 6,000 platform.

Data quality of the raw sequences was verified using FastQCv0.11.7. Subsequently, adapter sequences were excised using BBDuk adaptor and quality trimming version 38.84 (Bushnell, 2014). The sequences of the trimmed reads from both low- and high-passaged viruses were aligned to the Shaan virus sequence (GenBank accession no. MG230624.1) using the Geneious Prime Bowtie 2 plugin version 2.3.0 (Langmead & Salzberg, 2012). The expression levels of transcripts in cells infected with Shaan virus were quantified based on a reference annotation of Shaan virus (MG230624.1). Transcript abundance was calculated and normalized to the TPM value, considering read count, transcript length, and coverage depth. Three consensus genomic sequences obtained from Geneious Prime Bowtie 2 plugin version 2.3.0 (default setting) within the same group were aligned using the MAFFT v7.450 auto alignment algorithm (Katoh & Standley, 2013). The consensus genomic sequences of low- and high-passaged viruses served as reference sequences for mutation pattern and SNV analysis. The mean read depth of coverage for these genomic sequences is presented in Supplementary Table 1. Selected mutations were analyzed using the consensus genomic sequences of viruses passaged once in A549, HEK-293, and HRT-18 cells compared to Shaan virus in MARC-145 cells using Geneious software, with analysis of synonymous and non-synonymous amino acid substitutions also performed.

For SNV analysis, trimmed reads from both low-passaged and high-passaged viruses, passaged once in A549, HEK-293, and HRT-18 cells, were mapped to the consensus genomic sequences of the original viruses. Single nucleotide polymorphisms (SNPs) and INDELs were detected at minimum variant frequencies of 0.25 or 0.05, with a 10−6 maximum variant p-value and a 10−5 minimum strand-bias p-value (exceeding 65% bias) using the Geneious software workflow, “Map reads then find variations/SNPs”. The coverage and variant frequency data for the SNPs and INDELs across each experimental group are detailed in Supplementary Tables 2, 3, and 4. SNV results with coverage below 100× were omitted from the mutation analysis. Synonymous and non-synonymous amino acid substitutions at these SNVs were further examined.

Statistical analysis

All data in triplicate were subjected to a normality test using an unpaired t-test with multiple comparisons across groups. Statistical analyses were conducted using one-way ANOVA with Tukey’s multiple comparison test in GraphPad Prism version 9.0. Asterisks denote p-values as follows: *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001; ns, not significant.

Results

Quantitative analysis of Shaan virus replication in HEK-293, A549, and HRT-18 cells

Low- and high-passage viruses were infected into HEK-293, A549, and HRT-18 cells. At 24 hours post-infection, viral replication was compared by measuring total viral RNA, antigenomes, and infectious virions (Fig. 2). Relative viral RNA quantities in HRT-18 cells were significantly higher than those in A549 and HEK-293 cells, regardless of the Shann virus inoculum and the virus passage level. Additionally, when antigenomes produced during viral replication in host cells were measured, the relative amount of antigenomes was significantly higher in HRT-18 cells than in A549 and HEK-293 cells. Infectious virions were measured using TCID50 in MARC-145 cells, where a significantly higher number of infectious virions was observed in HRT-18 cells infected with either low- or high-passage viruses.

Comparison of Shaan virus-specific transcripts in low- and high-passage virus-infected HEK-293, A549, and HRT-18 cells

Using high-throughput sequencing, a total of 24 sets of sequencing data were obtained, representing triplicate samples from either low- or high-passage Shaan virus, as well as those-infected HEK-293, A549, and HRT-18 cells, as documented in Supplementary Table 1. The total read counts varied from 50,285,454 to 76,298,278. The reference mapping of trimmed reads against a reference genome (GenBank accession no. MG230624.1) showed different coverage values. In HRT-18 cells, the mean read depth for mapping ranged from 2,014.9 to 2,387.8 in the low-passage Shaan virus-infected cells and from 2,177.2 to 2,384.0 in the high-passage Shaan virus-infected cells. Notably, in HEK-293 cells, the mean read depth ranged from 4,553.6 to 6,452.6 in the low-passage Shaan virus-infected cells, but only from 9.4 to 17.0 in the high-passage Shaan virus-infected cells. In A549 cells, mean read depths were 517.0-1,049.1 after low-passage virus infection and 305.0-802.1 following high-passage virus infection. The percentage rate of mapped reads with a Phred score > 30 ranged from 98.2% to 98.7% in all groups.

After reference mapping the sequenced reads, Shaan virus-specific transcripts were compared based on different viral genes. The mapped reads were normalized and expressed as transcripts per million (TPM) values (Fig. 3). Overall, transcript profiles were found to be similar to those of other paramyxoviruses and Shaan virus (Wignall-Fleming et al., 2019; Lim et al., 2023). No significant differences were observed in the TPM values of each gene between cells infected with low- and high-passaged Shaan virus. However, transcripts associated with the nucleocapsid (N) and matrix (M) genes varied among the host cells. Shaan virus-specific transcripts associated with the N gene were the highest, followed by those associated with the M gene in MARC-145, A549, and HEK-293 cells, regardless of the virus passage level. In HRT-18 cells, transcripts associated with the M gene were the highest, followed by those associated with the N gene.

Genomic differences between low- and high-passaged Shaan viruses in MARC-145 cells

Consensus genomic sequences of low- and high-passaged Shaan viruses were obtained from triplicate high-throughput sequencing, using the reference genome of the Shaan virus (GenBank accession no. MG230624.1) for mapping the trimmed reads. Six mutations were identified in the low-passaged Shaan virus (p4), and nine mutations in the high-passaged Shaan virus (p44) (Fig. 4). Three mutations in the hemaglutinin-neuraminidase (HN) gene, specifically non-synonymous substitutions C9,724T (H239Y in amino acids), C9,803T (A265V), and T10,484C (I492T), were consistently observed in both virus passages. Additionally, in the low-passaged viruses, non-synonymous substitutions A5,876T (K435N) in the fusion protein (F) gene and G6,676A (E129K) in the small hydrophobic protein (SH) gene were observed. The high-passaged virus exhibited additional non-synonymous substitutions T4,590A (F7A) in the F gene, C11,194T (S49F), and C13,936T (T964I) in the large protein (L) gene. The mutations found in the low- and high-passaged viruses were consistent across triplicate sequencing runs.

We also analyzed single nucleotide variants (SNVs) in low- and high-passaged viruses. The consensus genomic sequences we obtained were used as references for SNV analysis. SNVs found in low-passaged Shaan virus (p4) were more numerous than those in the high-passaged Shaan virus (p44) (Fig. 5). With a minimum variant frequency of 0.25, six SNVs across the F, SH, TM, HN, and L genes were identified in the low-passaged virus, compared to only one SNV in the high-passaged virus. The SNV in the high-passaged virus was characterized by the insertion of adenine (A) at an A-rich site, potentially due to a sequencing error. With a minimum variant frequency of 0.05, 15 SNVs were observed in the low-passaged virus, whereas seven SNVs were detected in the high-passaged virus.

Mutations found in infected low- and high-passaged Shaan viruses after one passage in A549, HRT-18, and HEK-293 cells

Consensus genomic sequences from low-passaged (p4) and high-passaged (p44) Shaan viruses in MARC-145 cells served as references to generate consensus genomic sequences of the viruses passaged once in A549, HRT-18, and HEK-293 cells. These consensus genomic sequences of the once-passaged viruses were compared with the original sequences of low- and high-passaged Shaan viruses. No noticeable selected mutations were found when low-passaged and high-passaged Shaan viruses were passaged once in A549 cells (Fig. 6). Y(C/T) 8,057T on the TM gene and A13,706R (A/G) on the L gene were observed at the SNV sites in the virus passaged in A549 cells following infection with low-passaged Shaan virus (p4); similarly, A4,590W (A/T) on the F gene was observed at the SNV sites in the virus passaged in A549 cells following infection with high-passaged Shaan virus (p44).

In the case of HEK-293 cells, no selected mutations were observed following one passage of the low-passaged Shaan virus (p4). As noted in Supplementary Table 1, the low quality of the mapped reads precluded the detection of selected mutations in the viruses following one passage of the high-passaged Shaan virus (p44) in HEK-293 cells.

Selected mutations occurred more frequently in viruses passaged once in HRT-18 cells. When low-passaged Shaan virus (p4) was passed once through HRT-18 cells, nine selected mutations were detected. Among these, T2,834C (I372T) and T2,852C (F378S) in the phosphoprotein (P) gene, T5,876A (N435K) in the F gene, A6,676G (K129E) in the SH gene, and C10,484T (T492I) in the HN gene were non-synonymous substitutions. In the case of the high-passaged Shaan virus (p44) passed once through HRT-18 cells, 12 selected mutations were detected. These included consistent mutations like T2,834C (I372T) and T2,852C (F378S) on the phosphoprotein (P) gene, and C10,484T (T492I) on the HN gene from the same cells infected with low-passaged virus. Additional non-synonymous substitutions such as A4,590T (I7F) on the F gene and T11,195C (F49S) and T13,940C (I964T) on the L gene were also observed.

Single nucleotide variants (SNVs) found in low- and high-passaged Shaan viruses after one passage in A549, HRT18, and HEK293 cells

We also analyzed the SNVs of the viruses that were passaged once in A549, HRT-18, and HEK-293 cells with low- and high-passaged Shaan viruses. The consensus genomic sequences obtained for mutation pattern analysis served as references for the SNV analysis of each group. With a minimum variant frequency of 0.05, we found no consistent SNVs between viruses after one passage in A549 cells with low- and high-passaged Shaan viruses (Fig. 7A), except for the 2,415A insertion on the P gene. As the insertion site was in a repeated A sequence, this might be a sequencing error. Although inconsistent SNVs were observed in one sample of three replicates in the low passage-virus-infected A549 cells, all the SNVs from the other low-passaged Shaan virus passaged once in A549 cells matched those found in the original low-passaged virus. In the high-passaged Shaan virus-infected group, out of a total of eight SNVs, five SNVs consistently appeared in the same positions as in the original high-passaged Shaan virus.

A similar pattern was observed in HEK-293 cells (Fig. 7B). Here, all the SNVs in the viruses from one passage of low-passaged Shaan virus in HEK-293 cells matched those in the original low-passaged virus. However, due to low coverage, we were unable to interpret the SNVs in high-passaged virus-infected HEK-293 cells.

Notably, SNVs found in the viruses after one passage in HRT-18 cells were relatively unique compared to those in the other groups (Fig. 7C). Among the eight SNVs found in the viruses from one passage of low-passaged Shaan virus, two SNVs were consistent with the original virus, while the others were HRT-18 cell-specific. Additionally, of the eight SNVs found in the viruses from one passage of the high-passaged Shaan virus, two were consistent with the original virus.

Discussion

Viruses continuously evolve in the infected host. High mutation rates allow viruses a chance to survive through the selected mutants in a given host environment. Certain host environments, such as antiviral drugs, host switching, and immune responses, act as selection factors for the next generation of viruses. Because mutations occur randomly (Luria & Delbrück, 1943; Murray, 2016), given the host environment, certain selected mutations from the random mutation pool may drive viral evolution. In this context, the serial passage of viruses in a particular cell line typically results in highly adapted viruses with changes in virulence and host specificity, which can be applied to the development of attenuated vaccine strains and animal models of human viruses (Song et al., 2007; Sanders et al., 2016; Li et al., 2017; Dinnon et al., 2020).

In this context, we investigated selected mutation patterns in a Shaan virus isolate by conducting host-switching experiments in MARC-145 cells (Noh et al., 2018). We prepared low-passaged (p4) and high-passaged (p44) Shaan viruses in MARC-145 cells to infect new hosts, specifically A549, HRT-18, and HEK-293 cells of human origin, and then conducted high-throughput sequencing for genetic analysis. As illustrated in Fig. 4, distinct mutations were identified between the low-passaged (p4) and high-passaged (p44) Shaan viruses in MARC-145 cells. In SNV analysis, using a minimum variant frequency of 0.25, six SNVs were detected in the F, SH, TM, HN, and L genes of the low-passaged virus, whereas only one SNV was identified in the high-passaged virus. Given that SNVs in the population are linked to selected mutations that drive evolution (Casci, 2010; Li et al., 2022), the high-passaged Shaan virus (p44) may exhibit better adaptation to MARC-145 cells than the low-passaged virus (p4). Subsequently, we compared the replication and genetic changes between the highly adapted and less adapted viruses in MARC-145 cells when introduced to new host cells (A549, HRT-18, and HEK-293 cells).

We observed replication of Shaan virus in three human cell lines. Given that its receptor was identified as alpha 2,3 sialic acids and it could trigger an innate immune response in HEK293 and A549 cells (Jang et al., 2022; Lim et al., 2023), replication of Shaan virus in these cell lines is expected. Although both low- and high-passaged viruses were able to replicate and produce infectious virions after one passage in A549, HRT-18, and HEK-293 cells, the high-throughput sequencing data for generating a consensus genomic sequence was insufficient in HEK-293 cells infected with high-passaged Shaan virus (Supplementary Table 1). As high-passaged Shaan virus (p44) was better adapted to MARC-145 cells than low-passaged Shaan virus (p4), it may not replicate efficiently in HEK-293 cells. However, when the viruses successfully infected new host cells, selected mutations were observed after one passage in the new host cells, regardless of whether they were A549, HRT-18, or HEK-293 cells. When low-passaged Shaan virus (p4) was passaged, no mutations were found in HEK-293 cells and two in A549 cells, while nine selected mutations were observed in HRT-18 cells, despite all host cells being of human origin. Although reliable consensus genomic sequences from high-passaged Shaan virus-infected HEK-293 cells were not available due to low mean read depth, distinct differences in the selected mutations were evident between the high-passaged Shaan virus-infected A549 and HRT-18 cells. Interestingly, although data were derived from triplicate experiments, the mutation patterns consistently occurred in the same host cells. These findings suggest a host cell-specific selection pattern for the further evolution of Shaan viruses within a single passage, which may be linked to cell type rather than cell origin.

In this study, HRT-18 cells may serve as a unique host for Shaan viruses. Regardless of whether the Shaan virus infections were low- or high-passaged, viruses that had passed through HRT-18 exhibited more unique selected mutations than those from other cells. Furthermore, Shaan virus replication in HRT-18 cells differed from that in other cell types. As depicted in Fig. 2, Shaan viruses passaged in HRT-18 cells demonstrated significantly enhanced replication properties and yielded higher quantities of infectious virions. Additionally, the level of Shaan virus-specific transcripts associated with the N gene was highest in MARC-145, A549, and HEK-293 cells, regardless of the infection’s nature, whether low- or high-passaged, and transcripts related to the M gene were most abundant in HRT-18 cells. Relative to other cells, HRT-18 cells infected with low- and high-passaged virus had higher counts of unique SNVs, with six unique SNVs each (Fig. 7). Given that SNPs in a population are linked to selected mutations for evolution (Casci, 2010; Li et al., 2022), it can be inferred that these unique SNVs found in viruses post HRT-18 cell passage may contribute to a greater diversity of Shaan virus variants in these cells. HRT-18 cells are a known colorectal adenocarcinoma cell line. A previous study reported increasing frequencies of novel cryptic SARS-CoV-2 lineages in feces-associated wastewater (Smyth et al., 2022). Thus, additional studies examining the relationship between intestinal infection-specific mutations and the emergence of future variant viruses are warranted.

In conclusion, the selected mutations of high-passaged (p44) and low-passaged Shaan virus (p4) after host switching from MARC-145 cells to A549, HRT-18, and HEK-293 cells differed from each other, even when the switched host cells were of the same human origin. Compared to the low-passaged virus, the high-passaged Shaan virus did not generate sufficient high-throughput sequencing data to produce a consensus genomic sequence in HEK-293 cells. However, when analyzing the others, mutation patterns were consistent across the same host cells in triplicate experiments, suggesting a host cell-specific selection pattern for the next generation of Shaan viruses. Among the cells in this study, HRT-18 cells, originating from colorectal adenocarcinoma, produced a more distinct mutation pattern, as well as unique SNVs, during both high- and low-passaged Shaan virus infections. Therefore, this study provides potential evidence for host-specific selective mutation patterns by cell type, as well as host cells, for Shaan virus evolution.

Acknowledgments

This research was supported by the Young Researcher Program through the National Research Foundation of Korea (NRF), which is funded by the Ministry of Science and ICT of Korea (NRF-2020R1C1C1010440), the Bio & Medical Technology Development Program through the NRF, funded by the Ministry of Science & ICT (2021M3E5E3083402), and the Basic Science Research Program through the NRF, funded by the Ministry of Education (2020R1A6A1A06046235).

Data Availability

The partial genome sequence of the bat paramyxovirus isolate Bat-ParaV/B16-40 has been deposited in GenBank with the accession number MG230624. The RNA-seq raw data are available in the Gene Expression Omnibus database under the GEO Series accession number GSE201344. Additionally, raw sequence reads can be accessed under the BioProject accession number PRJNA830904 and the SRA accession number SRP371774.

Author Contributions

Conceptualization: Ji Yeong Noh, Hye Kwon Kim; Data curation: Ji Yeong Noh; Formal analysis: Ji Yeong Noh, Hye Kwon Kim; Funding acquisition: Hye Kwon Kim; Investigation: Ji Yeong Noh; Methodology: Ji Yeong Noh; Project administration: Ji Yeong Noh, Hye Kwon Kim; Resources: Ji Yeong Noh, Hye Kwon Kim; Supervision: Hye Kwon Kim; Visualization: Ji Yeong Noh; Writing-original draft: Ji Yeong Noh, Hye Kwon Kim.

Conflicts of Interest

The authors declare no conflicts of interest.

References

1 

Acevedo, A., Brodsky, L., & Andino, R. (2014) Mutational and fitness landscapes of an RNA virus revealed through population sequencing Nature, 505, 686-690 . Article Id (pmcid)

2 

Bushnell, B. (2014) Berkeley, CA (United States): BBMap: A fast, accurate, splice-aware aligner, In: Lawrence Berkeley National Lab. (LBNL)

3 

Casci, T. (2010) Population genetics: SNPs that come in threes Nat Rev Genet, 11(1), 8 .

4 

Das, H., Koizumi, T., Sugimoto, T., Chakraborty, S., Ichimura, T., Hasegawa, K., et al. (2000) Quantitation of Fas and Fas ligand gene expression in human ovarian, cervical and endometrial carcinomas using real-time quantitative RT-PCR British Journal of Cancer, 82, 1682-1688 . Article Id (pmcid)

5 

Dinnon, K.H., Leist, S.R., Schäfer, A., Edwards, C.E., Martinez, D.R., Montgomery, S.A., et al. (2020) A mouse-adapted model of SARS-CoV-2 to test COVID-19 countermeasures Nature, 586, 560-566 . Article Id (pmcid)

6 

Geoghegan, J.L., & Holmes, E.C. (2018) Evolutionary virology at 40 Genetics, 210, 1151-1162 . Article Id (pmcid)

7 

Katoh, K., & Standley, D.M. (2013) MAFFT multiple sequence alignment software version 7: Improvements in performance and usability Molecular Biology and Evolution, 30, 772-780 . Article Id (pmcid)

8 

Kim, H., Kwang, J., Yoon, I., Joo, H., & Frey, M. (1993) Enhanced replication of porcine reproductive and respiratory syndrome (PRRS) virus in a homogeneous subpopulation of MA-104 cell line Archives of Virology, 133, 477-483 .

9 

Jang, S.S., Noh, J.Y., Kim, M.C., Lim, H.A., Song, M.S., & Kim, H.K. (2022) α2,3-linked sialic acids are the potential attachment receptor for Shaan virus infection in MARC-145 cells Microbiol Spectr, 10(4), e0125622 . Article Id (pmcid)

10 

Lam, T.T., Jia, N., Zhang, Y.W., Shum, M.H., Jiang, J.F., Zhu, H.C., et al. (2020, Epub 2020 Mar 26) Identifying SARS-CoV-2-related coronaviruses in Malayan pangolins Nature, 583(7815), 282-285 .

11 

Langmead, B., & Salzberg, S.L. (2012) Fast gapped-read alignment with Bowtie 2 Nature Methods, 9, 357-359 . Article Id (pmcid)

12 

Li, J., Du, P., Yang, L., Zhang, J., Song, C., Chen, D., et al. (2022) Two-step fitness selection for intra-host variations in SARS-CoV-2 Cell Reports, 38, 110205 . Article Id (pmcid)

13 

Li, K., Wohlford-Lenane, C.L., Channappanavar, R., Park, J.-E., Earnest, J.T., Bair, T.B., et al. (2017) Mouse-adapted MERS coronavirus causes lethal lung disease in human DPP4 knockin mice Proceedings of the National Academy of Sciences, 114, E3119-E3128 . Article Id (pmcid)

14 

Lim, H.A., Noh, J.Y., Jang, S.S., Kim, M.C., Moon, S.H., Kim, H.Y., et al. (2023) Innate antiviral responses against Shaan virus infection in HEK293, A549 and MARC-145 cells and limited role of viperin against Shaan virus replication Heliyon, 9(12), e22597 . Article Id (pmcid)

15 

Luria, S.E., & Delbrück, M. (1943) Mutations of bacteria from virus sensitivity to virus resistance Genetics, 28(491) . Article Id (pmcid)

16 

McCrone, J.T., & Lauring, A.S. (2018) Genetic bottlenecks in intraspecies virus transmission Current Opinion in Virology, 28, 20-25 . Article Id (pmcid)

17 

Murray, A. (2016) Salvador Luria and Max Delbrück on random mutation and fluctuation tests Genetics, 202, 367-368 . Article Id (pmcid)

18 

Noh, J.Y., Jeong, D.G., Yoon, S.W., Kim, J.H., Choi, Y.G., Kang, S.Y., et al. (2018) Isolation and characterization of novel bat paramyxovirus B16-40 potentially belonging to the proposed genus Shaanvirus Sci Rep, 8(1), 12533 . Article Id (pmcid)

19 

Peck, K.M., & Lauring, A.S. (2018) Complexities of viral mutation rates Journal of Virology, 92, e01031-01017 . Article Id (pmcid)

20 

Rothenburg, S., & Brennan, G. (2020, Epub 2019 Oct 6) Species-specific host-virus interactions: Implications for viral host range and virulence Trends Microbiol, 28(1), 46-56 . Article Id (pmcid)

21 

Sanders, B.P., de los Rios Oakes, I., van Hoek, V., Bockstal, V., Kamphuis, T., Uil, T.G., et al. (2016) Cold-adapted viral attenuation (CAVA): highly temperature sensitive polioviruses as novel vaccine strains for a next generation inactivated poliovirus vaccine PLoS Pathogens, 12, e1005483 . Article Id (pmcid)

22 

Shi, X., Zhang, X., Chang, Y., Jiang, B., Deng, R., Wang, A., et al. (2016) Nonstructural protein 11 (nsp11) of porcine reproductive and respiratory syndrome virus (PRRSV) promotes PRRSV infection in MARC-145 cells BMC Veterinary Research, 12, 1-7 . Article Id (pmcid)

23 

Smyth, D.S., Trujillo, M., Gregory, D.A., Cheung, K., Gao, A., Graham, M., et al. (2022) Tracking cryptic SARS-CoV-2 lineages detected in NYC wastewater Nature Communications, 13, 1-9 . Article Id (pmcid)

24 

Song, D., Oh, J., Kang, B., Yang, J.S., Moon, H., Yoo, H.S., et al. (2007) Oral efficacy of Vero cell attenuated porcine epidemic diarrhea virus DR13 strain Research in Veterinary Science, 82, 134-140 . Article Id (pmcid)

25 

Wargo, A.R., & Kurath, G. (2012) Viral fitness: Definitions, measurement, and current insights Current Opinion in Virology, 2, 538-545 . Article Id (pmcid)

26 

Wignall-Fleming, E.B., Hughes, D.J., Vattipally, S., Modha, S., Goodbourn, S., Davison, A.J., & Randall, R.E. (2019) Analysis of paramyxovirus transcription and replication by high-throughput sequencing Journal of Virology, 93(17), e00571, 19 . Article Id (pmcid)

27 

Zhou, P., Yang, X.-L., Wang, X.-G., Hu, B., Zhang, L., Zhang, W., et al. (2020) A pneumonia outbreak associated with a new coronavirus of probable bat origin Nature, 579, 270-273 . Article Id (pmcid)

Supplementary Materials
Figures and Tables
Fig. 1

High-passaged and low-passaged Shaan virus passage scheme in A549, HEK293, and HRT18 cell lines. The original Shaan virus isolate was serially passaged in the MARC145 cell line. Both high-passaged and low-passaged Shaan virus cultures were passaged at an MOI of 0.5 in triplicate across each cell line. A sample from passage 1 of both the high-passaged and low-passaged Shaan virus was subjected to high-throughput sequencing analysis.

pnie-5-4-134-f1.jpg
Fig. 2

Viral quantitative analysis from high-passaged and low-passaged Shaan virus passaged in A549, HEK293, HRT18, and MARC145 cell lines. (A) Viral RNAs extracted from the first passage of Shaan virus in each cell line were quantified using real-time RT-PCR targeting the SH region of the virus. (B) The viral antigenome was quantified from the total RNA of each infected cell using reverse transcription and PCR with specifically designed primers. The relative viral RNA and antigenome levels were normalized using the amount of monkey and human GAPDH genes as controls. (C) Viral titers were measured by calculating infectious virus levels (TCID50/ml) in Shaan virus-infected cell lysates. Data were analyzed using one-way ANOVA with Tukey’s multiple comparison test. *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001; ns, not significant.

pnie-5-4-134-f2.jpg
Fig. 3

Differential expression of viral transcript in MARC145, A549, HEK293, and HRT18 cells infected with Shaan virus. The expression of viral gene transcripts, based on transcripts per million mapped reads (TPM), was compared in each cell line infected with 0.5 MOI of high-passaged and low-passaged Shaan virus (passage 1). N, nucleocapsid; P, phosphoprotein; M, matrix protein; F, fusion protein; SH, small hydrophobic protein; TM, transmembrane protein; HN, attachment haemagglutinin neuraminidase glycoprotein; L, large protein.

pnie-5-4-134-f3.jpg
Fig. 4

Comparison of consensus genomic sequence of original and high-passaged and low-passaged Shaan virus in MARC 145 cell. Multiple sequence alignment of consensus genomic sequences was carried out using MAFFT v7.450 integrated into Geneious Prime 2021.2.2. Selected mutations were identified in the F, SH, TM, HN, and L genes. Nucleotide and amino acid numbers (#NT, #AA) were annotated from a reference strain of bat paramyxovirus (GenBank accession no. MG230624).

pnie-5-4-134-f4.jpg
Fig. 5

SNVs found in high-passaged and low-passaged virus. The consensus genomic sequences of the high-passaged (B) and low-passaged (A) Shaan virus, inoculated in MARC145 cells, served as references for SNV analysis. SNVs were analyzed with a minimum variant frequency of 0.25 and 0.05 using Geneious Prime 2021.2.2. SNVs were marked with a red box and annotated with amino acid numbers at each viral gene site. The variant frequency at each SNV is expressed as a percentage value. The final row presents the synonymous or non-synonymous amino acid substitutions detected.

pnie-5-4-134-f5.jpg
Fig. 6

Comparison of selected mutations found after one passage and in high-passaged and low-passaged Shaan virus-infected cells in human cell line. Nucleotide sequences of high-passaged and low-passaged Shaan virus genes were compared across A549, HEK293, and HRT18 cells that were passaged once. In A549 and HRT18 cells, the selected mutations are highlighted in yellow with the corresponding amino acid number at the mutation site in viral genes. In HEK293 cells, no mutations were observed in the low-passaged Shaan virus. Results from the high-passaged virus in HEK293 cells (grey box) were excluded due to the low read depth (<100×) in mutation analysis. The resulting synonymous or non-synonymous amino acid substitutions are presented in the final row.

pnie-5-4-134-f6.jpg
Fig. 7

SNVs found in high-passaged and low-passaged virus after one passage in human cells. The consensus genomic sequence of the high-passaged and low-passaged Shaan virus inoculated in MARC145 cells served as a reference for SNV analysis. SNVs were analyzed at minimum variant frequencies of 0.25 and 0.05 in A549 (A), HEK293 (B), and HRT18 (C) cells. The SNVs are highlighted in red with the corresponding amino acid number at the viral gene site. The variant frequency at each SNV is expressed as a percentage. The SNVs found in the original low-passaged and high-passaged Shaan virus are indicated by blue boxes. In the HEK293 cells, results from the high-passaged Shaan virus-infected group (grey box) were excluded from analysis due to low SNV coverage (<100× read depth). The resulting synonymous or non-synonymous amino acid substitutions are presented in the final row.

pnie-5-4-134-f7.jpg
Supplementary Table 1

Sequencing data

Cell name No. passage Total reads Trimmed reads Mapped reads Mean read depth (×) The percentage of reads of phred score (>Q30)*
Trimmed reads Mapped reads
MARC145 p4
(Low passage) 		76155466 69476952 1630576 8280.2 98.3% 98.2%
75634052 69000772 1256180 6322.2 98.3% 98.2%
76298278 69709920 748856 3766.0 98.3% 98.2%
p44
(High passage) 		75536994 68748356 399789 2014.8 98.3% 98.2%
76099468 69025618 411691 2069.4 98.3% 98.2%
75747270 68793346 462013 2336.4 98.3% 98.2%
A549 p1 of
low passage 		70276644 65154680 205120 1049.1 98.4% 98.4%
57073026 48082936 125545 624.9 98.4% 98.0%
53316092 49406698 100752 517.0 98.4% 98.4%
p1 of
high passage 		50285654 46592890 59306 305.0 98.4% 98.4%
54227194 49983278 93271 477.5 98.1% 98.4%
52714662 48615816 156932 802.1 98.4% 98.3%
HEK293 p1 of
low passage 		75796120 71982628 1031234 5434.7 98.7% 98.7%
75707030 71871186 867148 4553.6 98.7% 98.6%
73091564 69472950 1221750 6452.6 98.7% 98.7%
p1 of
high passage 		74771938 70963538 1800 9.4 98.7% 98.7%
76279780 72405440 3256 17.0 98.7% 98.7%
76111894 71953910 2976 15.6 98.7% 98.7%
HRT18 p1 of
low passage 		58328530 53270462 465262 2387.8 98.5% 98.4%
59752932 54840618 397711 2059.2 98.6% 98.5%
53310344 48593456 392797 2014.9 98.5% 98.4%
p1 of
high passage 		55034724 49700814 470425 2384.0 98.3% 98.2%
61325484 55897850 431535 2217.6 98.5% 98.4%
59167894 53474980 430264 2177.2 98.4% 98.2%
Mean
[i]

*Base call accuracy (if phred assigns a Q score of 30 (Q30) to a base, this is equivalent to the probabiloty of an incorrect base call 1 in 1000 times.)

Supplementary Table 2

The raw data in SNV analysis in low- and high-passaged Shaan viruses after one passage in A549 cells

Gene Position Nucleotide
change 		Amino acid change Coverage Variant frequency (%)
#NT #AA
A549-low passaged virus
1 P 2415 232 (A)7→(A)8 - - 1006 23.90%
F 5876 435 T→A AAT>AAA N>K 1305 17.10%
6216 549 G→A GGC>AGC G>S 1234 5.90%
SH 6557 89 T→C CTA>CCA L>P 1278 7.50%
6676 129 A→G AAA>GAA K>E 1454 14.60%
TM 7614 168 T→C TAT>CAT Y>H 797 8.00%
8057 315 Y→T GAY>GAT D>D 976 61.80%
Y→C GAY>GAC D>D 976 38.20%
HN 9618 203 A→G ATA>ATG I>M 1073 9.20%
10484 492 C→T ACT>ATT T>I 1143 14.90%
10502 498 G→A AGA>AAA R>K 1198 8.30%
L 13723 892 T→G TGG>GGG W>G 2674 7.20%
15819 1590 T→A AAT>AAA N>K 4770 8.40%
2 N 1045 334 G→C GCT>CCT A>P 176 7.40%
1219 392 T→C TTG>CTG L>L 302 5.60%
1437 464 (A)6→(A)7 - - 298 6.70%
P 2248 2316 G→A GTT>ATT V>I 237 5.90%
2415 232 (A)7→(A)8 - - 66 16.70%
2706 329 A→G GAA>GAG E>E 95 11.60%
2719 334 A→G AAG>GAG K>E 105 11.40%
2754 345 T→C TCT>TCC S>S 127 7.90%
2793 358 A→G ATA>ATG I>M 151 8.60%
2863 382 A→G ATT>GTT I>V 149 8.10%
M 4152 265 G→DEL - - 264 6.10%
4398 347 A→G AAG>GAG K>E 68 5.90%
F 5085 172 T→C TTA>CTA L>L 166 5.40%
5113 181 T→C ATA>ACA I>T 145 6.20%
SH 6676 129 A→G AAA>GAA K>E 8220 15.40%
6851 187 C→T CCA>CTA P>L 184 6.00%
TM 7518 136 T→C TGG>CGG W>R 110 8.20%
7614 168 T→C TAT>CAT Y>H 164 10.40%
8057 315 Y→T GAY>GAT D>D 119 64.70%
Y→C GAY>GAC D>D 119 35.30%
8682 524 A→G AAA>GAA K>E 45 22.20%
HN 9252 82 AC→DEL - - 77 36.40%
10442 478 T→C CTA>CCA L>P 110 11.80%
10484 492 C→T ACT>ATT T>I 98 9.20%
L 12316 423 (A)5→(A)4 - - 36 22.20%
13114 689 T→C TTG>CTG L>L 163 7.40%
13133 695 T→C TTA>TCA L>S 126 7.90%
13609 854 A→C AAA>CAA K>Q 36 33.30%
13723 892 T→G TGG>GGG W>G 73 20.50%
16158 1703 A→G ATA>ATG I>M 89 5.60%
16175 1709 A→G AAG>AGG K>R 77 6.50%
16178 1710 A→G AAA>AGA K>R 79 6.30%
16189 1714 A→G ATG>GTG M>V 72 6.90%
16229 1727 A→G TAT>TGT Y>C 78 11.50%
16272 1741 A→G GAA>GAG E>E 57 8.80%
3 P 2415 232 (A)7→(A)8 - - 448 20.80%
F 5876 435 T→A AAT>AAA N>K 1305 14.80%
SH 6676 129 A→G AAA>GAA K>E 675 15.60%
TM 8057 315 Y→T GAY>GAT D>D 460 68.30%
Y→C GAY>GAC D>D 460 31.70%
HN 9618 203 A→G ATA>ATG I>M 610 12.60%
10484 492 C→T ACT>ATT T>I 618 17.20%
10502 498 G→A AGA>AAA R>K 677 5.30%
L 13723 892 T→G TGG>GGG W>G 191 11.00%
15819 1590 T→A AAT>AAA N>K 194 6.70%
A549-high passaged virus
1 P 1896 59 A→G AGA>AGG R>R 399 29.10%
2415 232 (A)7→(A)8 - - 273 27.50%
F 4590 7 A→T I>L 285 42.80%
TM 7119 3 T→C TAT>CAT Y>H 143 18.20%
7292 60 A→G CAA>CAG Q>Q 154 24.70%
7739 209 G→A GGG>GGA G>G 178 28.70%
L 16666 1873 T→C TTT>CTT F>L 92 5.40%
16674 1875 T→C TAT>TAC Y>Y 96 8.30%
2 P 1896 59 A→G AGA>AGG R>R 673 26.70%
2415 232 (A)7→(A)8 - - 469 25.40%
F 4590 7 A→T ATA>TTA I>L 521 41.10%
TM 7119 3 T→C TAT>CAT Y>H 188 13.80%
7292 60 A→G CAA>CAG Q>Q 321 34.90%
7739 209 G→A GGG>GGA G>G 295 28.10%
L 13940 964 T→C ATA>ACA I>T 112 7.10%
3 P 1896 59 A→G AGA>AGG R>R 1107 26.60%
2415 232 (A)7→(A)8 - - 776 31.30%
TM 7119 3 T→C TAT>CAT Y>H 407 15.00%
7292 60 A→G CAA>CAG Q>Q 589 28.90%
7739 209 G→A GGG>GGA G>G 509 26.50%
L 12519 490 G→A GTG>GTA V>V 267 6.40%
Supplementary Table 3

The raw data in SNV analysis in low- and high-passaged Shaan viruses after one passage in HEK293 cells

Gene Position Nucleotide
change 		Amino acid change Coverage Variant frequency (%)
#NT #AA
HEK293-low passaged virus
1 P 2415 232 (A)7→(A)8 - - 5881 20.20%
F 5876 435 T→A AAT>AAA N>K 4434 11.10%
SH 6676 129 A→G AAA>GAA K>E 6329 11.20%
TM 8057 315 Y→T GAY>GAT D>D 4128 43.10%
Y→C GAY>GAC D>D 4128 56.90%
HN 9618 203 A→G ATA>ATG I>M 3385 8.70%
10484 492 C→T ACT>ATT T>I 3470 10.60%
2 P 2415 232 (A)7→(A)8 - - 3895 18.40%
F 5876 435 T→A AAT>AAA N>K 3662 12.30%
SH 6676 129 A→G AAA>GAA K>E 4731 11.80%
TM 8057 315 Y→T GAY>GAT D>D 2871 46.00%
Y→C GAY>GAC D>D 2871 53.80%
3 P 2415 232 (A)7→(A)8 - - 6435 19.90%
F 5876 435 T→A AAT>AAA N>K 5244 11.00%
SH 6676 129 A→G AAA>GAA K>E 7214 10.90%
TM 8057 315 Y→T GAY>GAT D>D 4349 44.50%
Y→C GAY>GAC D>D 4349 55.30%
HN 9618 203 A→G ATA>ATG I>M 3793 8.60%
HEK293-high passaged virus
1 N 279 78 T→C TCT>TCC S>S 47 6.40%
P 1908 63 T→C CAT>CAC H>H 14 21.40%
2342 208 C→T CCC>CTC P>L 6 33.30%
2415 232 (A)7→(A)8 - - 5 80.00%
F 4590 7 A→T ATA>TTA I>L 12 33.30%
HN 12113 355 (T)7→(T)8 - - 6 33.30%
2 P 1896 59 A→G AGA>AGG R>R 22 36.40%
2415 232 (A)7→(A)8 - - 22 27.30%
M 3851 164 (T)3→(T)4 - - 45 8.90%
F 4590 7 A→T ATA>TTA I>L 13 69.20%
SH 6563 91 (A)6→(A)7 - - 22 45.50%
3 P 1896 59 A→G AGA>AGG R>R 20 25.00%
2415 232 (A)7→(A)8 - - 13 23.10%
2712 331 T→C AAT>AAC N>N 13 30.80%
M 3491 44 C→T ATA>TTA I>L 28 10.70%
TM 7292 60 A→G CAA>CAG Q>Q 15 40.00%
7394 94 G→A CCG>CCA P>P 9 44.40%
8751 547 T→C TAC>CAC Y>H 37 10.80%
L 12684 545 A→G AAA>AAG K>K 5 80.00%
12691 548 A→G AGA>GGA R>G 7 57.10%
12919-12920 624 AA→GG AAC>GGC N>G 8 50.00%
12928 627 A→G ACA>GCA T>A 9 44.40%
12955-12956 636 AA→GG AAA>GGA K>G 9 44.40%
12964 639 A→G AGA>GGA R>G 9 44.40%
16088 1680 G→A AGA>AAA R>K 10 60.00%
16490 1814 A→G TAC>TGC Y>C 4 50.00%
16500 1817 A→G TCA>TCG S>S 5 40.00%
Supplementary Table 4

The raw data in SNV analysis in low- and high-passaged Shaan viruses after one passage in HRT18 cells

Gene Position Nucleotide change Amino acid change Coverage Variant frequency (%)
#NT #AA
HRT18-low passaged virus
1 P 2048 110 T→C TTT>TCT F>S 1424 6.50%
2415 232 (A)7→(A)8 - - 1410 12.10%
2567 283 C→A GCG>GAG A>E 1765 8.20%
M 3666 103 C→T CTT>TTT L>F 4935 15.80%
4042 228 T→C GTC>GCC V>A 3945 5.50%
SH 6676 129 A→G AAA>GAA K>E 2029 99.90%
2 P 2048 110 T→C TTT>TCT F>S 1449 6.10%
2415 232 (A)7→(A)8 - - 1281 13.80%
M 3666 103 C→T CTT>TTT L>F 4856 15.40%
4042 228 T→C GTC>GCC V>A 3715 5.60%
F 5981 470 G→A AAG>AAA K>K 1935 16.40%
SH 6676 129 A→G AAA>GAA K>E 1594 99.90%
3 P 2048 110 T→C TTT>TCT F>S 1270 8.80%
2415 232 (A)7→(A)8 - - 1229 9.50%
2567 283 C→A GCG>GAG A>E 1673 9.50%
M 3666 103 C→T CTT>TTT L>F 3984 12.30%
F 5981 470 G→A AAG>AAA K>K 1444 99.80%
HN 10158 383 C→T ATC>ATT I>I 1746 8.80%
HRT18-high passaged virus
1 P 2048 110 T→C TTT>TCT F>S 1554 8.40%
2415 232 (A)7→(A)8 - - 1412 12.10%
M 3666 103 C→T CTT>TTT L>F 5144 15.80%
F 4964 131 T→C ACT>ACC T>T 1875 99.90%
5981 470 G→A AAG>AAA K>K 2184 14.70%
HN 10158 383 C→T ATC>ATT I>I 1866 9.50%
2 P 2415 232 (A)7→(A)8 - - 1322 10.50%
2567 283 C→A GCG>GAG A>E 1668 9.90%
M 3666 103 C→T CTT>TTT L>F 4768 13.70%
F 5981 470 G→A AAG>AAA K>K 1770 14.80%
TM 7739 209 G→A GGG>GGA G>G 410 100%
3 P 2048 110 T→C TTT>TCT F>S 1339 9.10%
2415 232 (A)7→(A)8 - - 1366 15.70%
2567 283 C→A GCG>GAG A>E 1745 9.00%
3666 103 C→T CTT>TTT L>F 5053 16.20%
F 4964 131 T→C ACT>ACC T>T 1792 99.90%
TM 7739 209 G→A GGG>GGA G>G 453 100%
HN 10158 383 C→T ATC>ATT I>I 1531 6.00%
Supplementary Table 5

Primer and probe of target gene detection with real time RT-PCR

Target gene Name Seq. (5′-3′) Ref.
For detection of viral RNA
Shaan virus PVM-F CCCAGGAGTATGGTTATCAAGTGAGG
SH gene PVM-R TCCATTGGGCTCTCTTTGTTTGC
PVM-P FAM-CCCATCCCAGACCAGCCACCAGACCC-TAMRA
For detection of antigenome
primer for cDNA synthesis N-P cD primer GAGCATCCAGAGACTTCCAGTGACGTTTGGCTTTGTCTG
Shaan virus antigenom BPV-NP-F GGATTAACCTCAAAACCAATGC
BPV-tail-R GAGCATCCAGAGACTTCCA
BPV-NP-P FAM-AAAGTGACATAGGCCAAGCTC-BHQ1
Human GAPDH gene hGAPDH-F GAAGGTGAAGGTCGGAGTC Das et al., 2000
hGAPDH-R GAAGATGGTGATGGGATTTC
hGAPDH-P HEX-CAAGCTTCCCGTTCTCAGCC-BHQ1
Monkey GAPDH gene mGAPDH-F TGACAACAGCCTCAAGATCG Shi et al., 2016
mGAPDH-R GTCTTCTGGGTGGCAGTGAT
mGAPDH-P HEX-TGGAAGGACTCATGACCACA-BHQ1